Abstract
Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer(Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling.Biodiversitas 25:355-360.Rusa deer is a vulnerable species witha large geographic range but natively inhabitsJava and Bali.Despite the wide distribution, its native population is declining, raising a concern about a small population’s adverse genetic effect.Itencourages genetic studiesto providebaselinedatathat has beenvacant recently. This research aimedto demonstrate anapplication of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This researchalsoaimedto providegenetic variation of the native deer population as baseline data. The research sites wereBaluran, Alas Purwo in East Java, and Bali Barat national parks from whichfecalsamples were collected. Moreover, 20DNA sampleswere isolated from the feces using a kit(Dneasy PowerSoil ProfromQiagen)and amplified at the control region gene usingaforward: AAACCAGAAAAGGAGAGCAACand a reverse:TCATCTAGGCATTTTCAGTGCCprimer. The amplicons were sequenced,and the number of Haplotypes (Hn), Haplotype diversity(Hd), nucleotide diversity (), sitepolymorphism,and phylogeographic tree weredetermined. The result showed that all the sequenceshadcoverage of 100% and identity >98% with the Rusa timorensissequence available in the GenBank.Furthermore, we found Hn=11, Hd=0.88,=0.005and 30 sitepolymorphisms.Therefore, compared to an introduced population, theRusa deer has a richer Hdand higher site polymorphism but a poorer.Furthermore, we found that the Baluran population hadhigh Hd, , and is possibly forminga distinctclade.
SDGs:
1. SDGs 4:Quality Education
2. SDGs 11:Sustainable Cities and Communities
3. SDGs 12:Responsible Consumption and Production
4. SDGs 13:Climate Action
5. SDGs 15:Life on Land
Link Dokumen:
Download