• UGM
  • Academic Portal
  • IT Center
  • Library
  • Research
  • Webmail
  • Informasi Publik
  • Languages
Universitas Gadjah Mada Fakultas Kehutanan
Universitas Gadjah Mada
  • Tentang Kami
    • Visi dan MIsi
    • Kelembagaan Fakultas
    • Sejarah dan Perkembangan
    • Staff Pendidik
  • Akademik
    • Sistem Pendidikan
    • Departemen
    • Sistem Kredit Semester
    • BUKU PANDUAN AKADEMIK
  • KEMAHASISWAAN
    • KEMAHASISWAAN
    • LEM
    • PPSMB Pelestari
  • Penelitian dan Publikasi
    • Berita Penelitian dan Publikasi
    • Penelitian
    • Publikasi
    • Kekayaan Intelektual
    • Jangka Benah
  • Pengabdian Masyarakat
    • Pengabdian Dosen
    • Kerja Sama
    • WANAGAMA
    • KHDTK NGANDONG-GETAS
  • Beranda
  • berita penelitian dan publikasi
  • Publication: Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling

Publication: Genetic variation of the native Rusa deer (Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling

  • berita penelitian dan publikasi
  • 23 January 2024, 00.42
  • Oleh: Bag. Riset & Literasi
  • 0

Abstract
Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer(Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling.Biodiversitas 25:355-360.Rusa deer is a vulnerable species witha large geographic range but natively inhabitsJava and Bali.Despite the wide distribution, its native population is declining, raising a concern about a small population’s adverse genetic effect.Itencourages genetic studiesto providebaselinedatathat has beenvacant recently. This research aimedto demonstrate anapplication of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This researchalsoaimedto providegenetic variation of the native deer population as baseline data. The research sites wereBaluran, Alas Purwo in East Java, and Bali Barat national parks from whichfecalsamples were collected. Moreover, 20DNA sampleswere isolated from the feces using a kit(Dneasy PowerSoil ProfromQiagen)and amplified at the control region gene usingaforward: AAACCAGAAAAGGAGAGCAACand a reverse:TCATCTAGGCATTTTCAGTGCCprimer. The amplicons were sequenced,and the number of Haplotypes (Hn), Haplotype diversity(Hd), nucleotide diversity (), sitepolymorphism,and phylogeographic tree weredetermined. The result showed that all the sequenceshadcoverage of 100% and identity >98% with the Rusa timorensissequence available in the GenBank.Furthermore, we found Hn=11, Hd=0.88,=0.005and 30 sitepolymorphisms.Therefore, compared to an introduced population, theRusa deer has a richer Hdand higher site polymorphism but a poorer.Furthermore, we found that the Baluran population hadhigh Hd, , and is possibly forminga distinctclade.

SDGs:
1. SDGs 4:Quality Education
2. SDGs 11:Sustainable Cities and Communities
3. SDGs 12:Responsible Consumption and Production
4. SDGs 13:Climate Action
5. SDGs 15:Life on Land

Link Dokumen:
Download

Leave A Comment Cancel reply

Your email address will not be published. Required fields are marked *

*

Universitas Gadjah Mada

FAKULTAS KEHUTANAN
Universitas Gadjah Mada
Jl. Agro No. 1 Bulaksumur Yogyakarta 55281
Telp. (0274) 512102, 6491420 Fax. (0274) 550541
Email: fkt@ugm.ac.id

UNIVERSITY ADMISSION

  • SNMPTN
  • SBMPTN
  • PBUTM
  • UTUL

DEPARTMENT

  • Forest Management
  • Forest Product Technology
  • Silviculture
  • Forest Resource Conservation

Informasi Publik

  • Permohonan Informasi Publik
  • Daftar Informasi Tersedia Secara Berkala
  • Daftar Informasi Tersedia Setiap Saat

© FKT - Universitas Gadjah Mada

KEBIJAKAN PRIVASI/PRIVACY POLICY

[EN] We use cookies to help our viewer get the best experience on our website. -- [ID] Kami menggunakan cookie untuk membantu pengunjung kami mendapatkan pengalaman terbaik di situs web kami.I Agree / Saya Setuju