Abstract
Ecotherapy healing forest (EHF) is a new approach that utilizes forest resources for health and increasing ecosystem value. EHF is an alternative that functions to provide physical and mental health interventions by utilizing the environment and forest ecosystem. Ecotherapy healing forest can also help ensure that environmental conditions can always be maintained, so that people’s health and welfare can improve, in line with the Sustainable Development Goals (SDGs). This research was conducted in the area of Mount Kelam National Tourism Park, Sintang Regency, with data collection time in August 2022 – January 2023. Location selection is determined purposively by considering accessibility, travel time, and location value. The method used uses a site identification approach carried out on the routes available at NTP. The suitability of the Mount Kelam NTP location as a new EHT location was carried out by taking measurements at 6 location points covering an area approximately 8 ha, including measurements of vegetation, microclimate, noise level, wind speed and negative ion content. Based on the results of the analysis of site identification, community perceptions and preferences, site carrying capacity, and thermal comfort, the Mount Kelam Sintang Natural Tourism Park conservation area is very representative of being a site of ecotherapy healing forest which is beneficial for health. The final results of this research are described in the form of design recommendations for the site of ecotherapy healing forest at the six observation points.

SDGs:
SDG 3 : Kehidupan Sehat dan Sejahtera
SDG 8 : Pekerjaan Layak dan Pertumbuhan Ekonomi
SDG 13 : Penanganan Perubahan Iklim
SDG 15 : Ekosistem Daratan

Link Dokumen:
Download

Abstract
Numerous countries have deployed significant efforts to reduce the amount of CO2released intothe atmosphere. Carbon capture and storage is widely regarded as a mitigation technique that cansignificantly reduce CO2emissions. A crucial stage in carbon capture and storage is CO2adsorptionusing a membrane. Cellulose acetate has demonstrated excellent properties as a membranematerial. In this study, we examined the potential of cellulose acetate membrane (CAM) for CO2gas capture. Two forms of CAM were developed for this study, with and without the addition ofglycerol.Scanning Electron Microscope(SEM),Fourier Transform Infrared(FTIR), and CO2adsorption analyses were used to characterise CAM in numerous ways. The analysis revealedthat the addition of glycerol improved the gas adsorption properties of the material. Theincorporation of glycerol into the cellulose acetate matrix resulted in an observed augmentationin both the diameter and pore size. The adsorption properties of CO2are significantlyinfluenced by the microscopic structure of the cellulose acetate membrane. The CAM can beviewed as a possible material for CO2adsorbers.

SDGs:
1. SDGs 7:Affordable and Clean Energy
2. SDGs 9:Industry, Innovation, and Infrastructure
3. SDGs 12:Responsible Consumption and Production
4. SDGs 13:Climate Action

Link Dokumen:
Download

Abstract:
Swietenia mahagoni is one of the commercial timbers in Indonesia. Mahogany heartwood is an important characteristic as it relates to the natural durability and aesthetics of the wood. Lipophilic extractives are known to be involved in the heartwood formation process. Therefore, this study aims to determine the lipophilic compounds associated with heartwood formation. The n-hexane extract from sapwood and heartwood samples (1 to 5 years) was analyzed by gas chromatography-mass spectrometry. The results showed that the content of n-hexane extract ranged from 0.76% to 2.45% based on dry wood. The main group of compounds identified in the lipophilic fraction consisted of sterols (β-sitosterol, stigmasterol, campasterol, and cyclolaudenol), fatty acids (palmitic, oleic, linoleic, and stearic acid), and hydrocarbons (pentadecane, 1-octadecane, hexadecane, cyclotetracosane, cycloeicosane, and cyclooctacosane) after heartwood formation. In addition, the hydrocarbon fraction was the largest, followed by sterols, fatty acids, and 1-heneicosanol. In the radial variation, the distribution of fatty acids was greater in the sapwood than in the heartwood (4-year-old). However, the reverse pattern was found at the age of 5 years. The lipophilic fraction was generally more abundant in the heartwood compared to the sapwood, especially at 5 years of age, with much higher levels than when the heartwood was forming (4 years). These findings show that when the heartwood formation begins, the lipid composition was not fully metabolized at the beginning of heartwood formation compared to 5-year-old trees.
Keywords: lipophilic extractive; heartwood formation; sterols; fatty acids; Swietenia mahagoni

SDGs:
1. SDGs 4:Quality Education
2. SDGs 12:Responsible Consumption and Production
3. SDGs 13:Climate Action
4. SDGs 15: Life on Land

Link Document:
Download

Abstract
Iman MH, Kuswandi PC, Subrata SA. 2024. Genetic variation of the native Rusa deer(Rusa timorensis) in Java and Bali (Indonesia) as revealed using non-invasive sampling.Biodiversitas 25:355-360.Rusa deer is a vulnerable species witha large geographic range but natively inhabitsJava and Bali.Despite the wide distribution, its native population is declining, raising a concern about a small population’s adverse genetic effect.Itencourages genetic studiesto providebaselinedatathat has beenvacant recently. This research aimedto demonstrate anapplication of non-invasive sampling to collect DNA samples and a simple procedure to obtain and analyze genetic data for the Rusa deer. This researchalsoaimedto providegenetic variation of the native deer population as baseline data. The research sites wereBaluran, Alas Purwo in East Java, and Bali Barat national parks from whichfecalsamples were collected. Moreover, 20DNA sampleswere isolated from the feces using a kit(Dneasy PowerSoil ProfromQiagen)and amplified at the control region gene usingaforward: AAACCAGAAAAGGAGAGCAACand a reverse:TCATCTAGGCATTTTCAGTGCCprimer. The amplicons were sequenced,and the number of Haplotypes (Hn), Haplotype diversity(Hd), nucleotide diversity (), sitepolymorphism,and phylogeographic tree weredetermined. The result showed that all the sequenceshadcoverage of 100% and identity >98% with the Rusa timorensissequence available in the GenBank.Furthermore, we found Hn=11, Hd=0.88,=0.005and 30 sitepolymorphisms.Therefore, compared to an introduced population, theRusa deer has a richer Hdand higher site polymorphism but a poorer.Furthermore, we found that the Baluran population hadhigh Hd, , and is possibly forminga distinctclade.

SDGs:
1. SDGs 4:Quality Education
2. SDGs 11:Sustainable Cities and Communities
3. SDGs 12:Responsible Consumption and Production
4. SDGs 13:Climate Action
5. SDGs 15:Life on Land

Link Dokumen:
Download

Abstract:
Mount Merapi National Park (TNGM) is one of the active volcanos in Indonesia. It has past volcano eruption history since 1911 up to date. Specifically, Plawangan Hill, a part of the TNGM, has periodically experiencedvolcanic eruptions.This study aimedto examine the quantities of nutrients in the soil and the vegetation growthin affected areasandto estimate when it would be feasible to start planting on Plawangan Hill shortly after a volcanic eruption.A field survey and a soil laboratory examination were conducted to obtain the data. Plawangan Hill’s Digital Elevation Model (DEM)was classified from very low to very high classes,while the Digital Surface Model (DSM)was categorized from flat to very steep slopes. The results demonstrated that the pH of thesoil was typically somewhat acidic (5.93-6.54), while the soil’s nitrogen content was found to be low to medium, and both phosphorusand potassium levels were typically very low. The carbon-to-nitrogen ratio wasgenerally categorized into the medium, while the organic C ranged from low to medium (1.44% to 3.22%).The soil’s totalN, totalK, organic matter, carbon, and C:Nratioincreased by the erupted material age. The vegetation growth was excellent in indirect(IA)and directly affected(DA)conditions, as indicated by their diameter at breast height(Dbh)and height(H). The correlationbetween soilcharacteristicsandvegetationgrowth differedin IA and DA areas. Thisstudy found that Plawangan Hill’s land cover in 2023 varied from low to high regardingvegetation classifications. As a result, volcanic materials significantly contributedtoPlawangan Hill’s soilcharacteristics and vegetation growth. The soil needed at least four years to recover and support vegetation growth following a volcanic eruption.

SDGs:
1. SDGs 4:Quality Education
2. SDGs 11:Sustainable Cities and Communities
3. SDGs 13:Climate Action
4. SDGs 15:Life on Land

Link Dokumen:
Download

Abstract
Intensive silviculture plays a crucial role in selecting superior clones with high productivity. The use of superior clones needs to be accompanied by appropriate environmental conditions. The arrangement of growing space is one way for teak clones to grow optimally and produce quality wood products. It can choose initial spacing in the early growth phase and thinning intensity in the later growth phase. This study aims to assess and determine the growth of superior teak clones with different thinning intensities at different planting distances to optimize the growing space. Optimizing growth space also has the potential for intercropping under the stand to produce more diverse products. The research design was a Split-plot design with three blocks as replications. The main plots had four spacings, including 3 m x 3 m, 6 m x 2 m, 8 m x 2 m, and 10 m x 2 m. Subplots were thinning intensity, including 0% thinning (control), 25% thinning (moderate thinning), and 50% thinning (heavy thinning). The results showed that spacing could significantly affect diameter growth. Silvicultural thinning showed significant differences in diameter growth, CADI, height, and volume per hectare. The diameter growth showed higher growth at larger spacing and higher thinning intensity, while the volume per hectare was low. The tree height parameter increased with the thinning intensity. The CADI after two years of thinning increased by 14–42% at 25% thinning intensity and increased by about 35–48% at 50% thinning intensity compared to no thinning at each spacing. Meanwhile, the volume per hectare was lower at wider spacing and decreased at a high thinning intensity. These results indicate an increase in spacing, and thinning accelerates diameter growth and provides better-growing space for intercrops.

SDGs:
1. SDGs 8:Decent Work and Economic Growth
2. SDGs 12:Responsible Consumption and Production
3. SDGs 13:Climate Action
4. SDGs 15:Life on Land

Link Dokumen:
Download

Abstract
Reclaiming tropical coal mines is a formidable task. The symbiosis between AMF and plants like Nauclea orientalis is crucial for thriving in tough environments. This study aimed to assess the potential of native AMF and N. orientalis in overburden pit soil for post-mining reclamation. Fifteen AMFs isolated from post-coal mining were screened for nutrient uptake, plant growth, and colonization using Sorghum bicolor as hostplant. The top three AMFs were rDNA amplicon sequenced and further analyzed for their spore ontogeny at varying pH and aluminum concentrations. The most promising AMF strains were then tested by inoculating them into N. orientalis growing in four soil substrates: soil (S), overburden (O), soil mixed overburden (v/v 1:1, M1), and soil mixed overburden (v/v 1:3, M2). Non-inoculated plants served as control. Plant biomass, AMF colonization, root and shoot P, Al, Fe concentrations, and soil chemical properties were analyzed. Phylogenetic analysis revealed the three best-screened AMFs were Acaulospora mellea, Uncultured Glomus gene clone: N8-89, and Glomus clarum isolate AU402B. Overburden resulting from coal mining led to decreased soil pH and P levels while increasing concentrations of Al3+, H+, S, Fe, and Mn. A. mellea, Uncultured Glomus, and G. clarum demonstrated high P, K, Mg uptake and yield. G. clarum exhibited the best spore ontogeny at pH 4.5 and Al concentrations of 2 µM and 5 µM. Additionally, G. clarum, alongside N. orientalis, mitigated the toxicity of soil Al, Fe, and Mn. G. clarum improved plant growth in M1 and M2 and produced high plant biomass in OM and M2M. These findings suggest that the application of selected native AMF can significantly enhance plant adaptation in challenging conditions, potentially reducing the necessity for topsoil in reclamation efforts by 50–75 %.

SDGs:
1. SDGs 8: Decent Work and Economic Growth
2. SDGs 12:Responsible Consumption and Production
3. SDGs 13:Climate Action
4. SDGs 15:Life on Land

Link Dokumen:
Download

Abstract
The implementation of degraded land rehabilitation programs and community-based forest management certification is widely recognised to enhance the status of wono land cover and aid in climate change mitigation. The expansion of the restoration efforts can be monitored using satellite images to track the progress of operations by observing changes in land cover area. Community forest certification also can enhance the success of land restoration endeavours. Therefore, this study aimed to show the change in forest land cover and the amount of carbon stored from 1972 to 2021. Landsat imagery was used to depict land cover conditions in 1972, 1982, 1993, 2000, 2008, 2014, and 2021, before and after the implementation of restoration and community forest certification programs. The Normalized Difference Vegetation Index approach was employed for satellite images captured in 1972 and 1982, while the Forest Canopy Density method was employed for images in 1993, 2000, 2008, 2014, and 2021, to illustrate the progressive increase in wono land cover. Meanwhile, carbon storage was analysed from 1972 to 2021 using national carbon storage conversion. The results indicated that restoration activity and the establishment of community forest certification increased wono area and carbon storage, which totalled 55.90 ha and 5,499.04 t C between 1972 and 2021. Augmenting carbon storage within wono land cover constituted an effective strategy for mitigating climate change.K

SDGs:
1. SDGs 4:Quality Education
2. SDGs 8:Decent Work and Economic Growth
3. SDGs 11:Sustainable Cities and Communities
4. SDGs 13:Climate Action
5. SDGs 15:Life on Land

Link Dokumen:
Download

SDGs:
1. SDGs 4:Quality Education
2. SDGs 8:Decent Work and Economic Growth
3. SDGs 11:Sustainable Cities and Communities
4. SDGs 13:Climate Action
5. SDGs 15:Life on Land

Abstract
Storage of Melaleuca cajuputi leaves and twigs affectsthe quality and yield of eucalyptus oil produced. The availability of raw materials from eucalyptus plantation forests is abundant, but the production capacity of eucalyptus biomass cooking kettles at PMKP Jatimunggul is insufficient, causing a decrease in yield because raw materials are stored for days and the transportation time from the BKPH supplier to PMKP Jatimunggul takes one day. Meanwhile, raw materials are always sent every day from 4 KPH suppliers. Harvesting eucalyptus leaves and twigs that do not comply with the SOP can also reduce the yield of eucalyptus oil. The research aims to formulate a raw material management strategy to improve the yield quality and cineol content of eucalyptus oil. Data obtained from interviews with questionnaires wereanalyzed using SWOT. The research results show that the raw material management strategy has a total strength internal factor score of 3.892; weakness of 3.785; chance of 3.906; and threats of 3.489. The strategic position for managing raw materials and eucalyptus oil is located in quadrant I with coordinate values (0.107; 0.417). Aggressive Strategy (Strengths –Opportunities) to seek opportunities from BKPH Subang and PMKP Jatimunggul based on their strengths. Then the company will increase production of raw materials for eucalyptus leaves and twigs.

SDGs:
1. SDGs 4:Quality Education
2. SDGs 8:Decent Work and Economic Growth
3. SDGs 12:Responsible Consumption and Production
4. SDGs 13:Climate Action
5. SDGs 15:Life on Land

Link Dokumen:
Download